Skip to main content

Table 3 Oligonucleotide sequences of primers and probe used in AHV-1 FQ-PCR detection

From: Detection of anatid herpesvirus 1 gC gene by TaqMan™ fluorescent quantitative real-time PCR with specific primers and probe

Name Type Sequences (5' to 3') Length
(nt)
Amplicon size
(bp)
P1 Forward CGGAATTC CAAAACGCCGCACAGATGAC 28 1296
P2 Reverse CCCTCGA GGTATTCAAATAATATTGTCTGC 30  
P3 Forward GAAGGACGGAATGGTGGAAG 20 78
P4 Reverse AGCGGGTAACGAGATCTAATATTGA 25  
P Probe FAM-CCAATGCATCGATCATCCCGGAA-TAMRA 23  
  1. The underlined sequences of P1 and P2 are Eco R I and Xho I restriction sites respectively