Skip to main content

Table 3 Best shRNAs targeting sequences in more than one MSA.

From: An RNAi in silico approach to find an optimal shRNA cocktail against HIV-1

a HXB2 Coordinates b shRNA Sequence c Score d Targeted MSAs e Min_ST f Max_ST g Total
n2702-2725 h GCCTGAAAATCCATACAATACTCC 5 7,8,9,10 33 (7) 741 (9) 848
  GCCTGAAAATCCATAt AATACTCC 6.5 2,9 6 (2) 223(9) 229
  GCCTGAAAAc CCATACAATACTCC 5 2,9 4 (2) 62 (9) 66
n2333-2356 AGCAGATGATACAGTAg TAGAAGA 6 1,2,3,4,5,6 10 (1) 18 (6) 85
  AGCAGATGATACAGTg TTAGAAGA 6 1,2,3,4,5,6 23 (1) 33 (4,6) 174
  AGCAGATGATACAGTATTAGAg GA 3 1,2,3,4,5,6 12 (1,2) 15 (3,5) 82
  AGCAGATGATACAGTAc TAGAAGA 6 1,2,4,5,6,10 6 (10) 17 (4,5,6) 81
  AGCAGATGAc ACAGTATTAGAAGA 7 1,2,3,4,5,6 21 (1,2) 31 (3,4,5,6) 166
  AGCAGATGATACAGTATTg GAAGA 6 1,2,3,4,5,6 11 (1,2) 15 (3,4,5,6) 82
  g GCAGATGATACAGTATTAGAAGA 7 1,2,3,4,5,6 16 (1) 27 (6) 139
  h AGCAGATGATACAGTATTAGAAGA 7 1,2,3,4,5,6,10 21 (10) 920 (6) 4854
r2556-2579 AGt CCTATTGAa ACTGTACCAGTA 2.5 9 1013 (9) 1013 (9) 1013
r2574-2597 CCAGTAAAATTAAAa CCAGGAATG 2 9, 10 60 (9) 74 (10) 208
  h CCAGTAAAATTAAAGCCAGGAATG 3 9, 10 926 (9) 1267 (10) 3448
  CCAGTAAAATTg AAGCCAGGAATG 2 9, 10 48 (9) 77 (10) 202
r2702-2725 GCCTGAAAATCCc TACAATACTCC 3.5 9 67 67 67
  1. a Genome position according HXB2 numbering system
  2. b In lowercase, nucleotides different from HXB2 reference genome
  3. c Score is given by the accomplishment of specific sequence features
  4. d Multiple sequence alignments numbered as follows:
  5. 1. POL_DNA_No_Recombinants
  6. 2. GENOME_DNA_No_Recombinants
  7. 3. POL_DNA_GroupM_Recombinants
  8. 4. GENOME_DNA_GroupM_Recombinants
  9. 5. POL_DNA_All_Subtypes
  10. 6. GENOME_DNA_All_Subtypes
  11. 7. ZDV-3TC-ABC
  12. 8. D4T-3TC-NVP
  13. 9. ZDV-3TC-EFV
  14. 10. 2299_Resistant_Isolates
  15. e Min_ST, Minimun number of sequences targeted in an MSA. In parenthesis, the specific number of MSA, to which targeted sequences belong.
  16. f Max_ST, Maximun number of sequences targeted in an MSA. In parenthesis, the specific number of MSA, to which targeted sequences belong.
  17. g Total number of sequences targeted in all the MSAs
  18. h shRNA sequence corresponds to HXB2 reference genome
  19. nshRNAs from these regions were found in non-resistant MSA, despite some of them might target resistant viral sequences.
  20. rshRNAs from these regions were found in resistant MSA.