From: Functional dissection of the alphavirus capsid protease: sequence requirements for activity
Mutation | Primer | Nucleotide sequence (5'-3') |
---|---|---|
Wt | Flagchik cap_fwd | aagcttatggactacaaagacgatgacgataagaccatggagttcatccc |
EGAEEW (wt) | ChikcapXmaI_WT_rev | atcccgggtccactcttcggctc |
Δ46 AA (deletes aa 216-261) | ChikcapΔ46_rev | atcccgggttctaccgctgtcccc |
W261A (EGAEEA) | ChikcapW-A_rev | atcccgggtcgc ctcttcggccc (4) |
A258E (EGE EEW) | ChikcapA-E_rev | atcccgggtccactcttcttc cccctcgg (5) |
A258 S (EGS EEW) | Chikcap3A-Sr_rev | atcccgggtccactcttcgga cccctcgg (6) |
E256A (A GAEEW) | Chikcap_E-A_rev | atcccgggtccactcttcggccccggc (7) |
A258T (EGT EEW) | ChikcapA-Tr_rev | atcccgggtccactcttcggt cccctcgg (8) |
E260 D (EGAED W) | Chikcap_E-D_rev | atcccgggtccaatc ttcggccc (9) |
E260A (EGAEA W) | Chik_cap_E-A_rev | atcccgggtccacgc ttcggccc (10) |