Skip to main content

Table 6 List of primers used for the deletion of ORF A and C

From: Deletion of 1.8-kb mRNA of Marek's disease virus decreases its replication ability but not oncogenicity

Primers Sequence 5'-3'
1.8-kb mRNA(A+C)-kanR-F 5'-aaaggatctcaattaatagaacggcgattttttatttacggcgatatttg
CGTGTAGGCTGGAGCTGCTTCa-3'
1.8-kb mRNA(A+C)-kanR-R 5'-aaacagtttctaatcgaaagcgttaccgaacttgtctttaatgagaatcc
CATTCCGGGGATCCGTCGACa-3'
  1. aFor primers 1.8-kb(A+C)-kanR-F, 1.8-kb(A+C)-kanR-R, underlined sequences indicate the sequences from pKD13 used to amplify the KanR gene cassete with FRT, and sequences in bold indicate MDV sequence flanking the ORF (A+C).