Skip to main content

Table 1 Primer and probe sequences for the duplex real-time RT-PCR for EEEV and WEEV

From: A duplex real-time reverse transcriptase polymerase chain reaction assay for detecting western equine and eastern equine encephalitis viruses

Name of primer or probe Sequence (5'→3') Nucleotide start
EEE-F TGTGCGTACCTCCTCATCGTT 335
EEE-R GACTGGCGTGAATCTCTGCTT 414
EEE-Probe HEX-AGCAGCCTACCTTTCCGACAATGGTTGTC-TAMRA 364
WEE-F AGGGATACCCCCGAAGGTT 8220
WEE-R GTGAATAGCACACGGGTGGTT 8322
WEE- Probe CTTTCGAATGTCACGTTCCCATGCG 8274