Skip to main content

Table 1 sequences and positions of designed siRNA

From: Inhibitory effect of small interfering RNA on dengue virus replication in mosquito cells

No Sequence(5'-3') Position
DenSi-1 AACGGAACCAGAUGACGUUGA 432
DenSi-2 AACUGUGCAUUGAAGCCAAAA 929
DenSi-3 AACAGGGCUAGACUUCAAUGA 1320
DenSi-4 AAGAAGAAUGGAGCGAUCAAA 133
control siRNA UUCUCCGAACGUGUCACGUdT --
  1. Four siRNA sequences (table 1) against different parts of the DEN-1 genome were designed, the positions refered to DEN-1 reference strain (GenBank access No. EU848545). Negative siRNA was supplied by HiPerFect Transfection Reagent kit (Qiagen, German)