Skip to main content

Advertisement

Table 1 Primers and probe used to detect KIPyV, WUPy and MCPyV.

From: Newly discovered KI, WU, and Merkel cell polyomaviruses: No evidence of mother-to-fetus transmission

PCR and Virus Primer Sequence 5 → 3   Region Amplicon size
  Forward Reverse   
Nested PCR outer primers     
KIPyV, WUPyV ATCTRTAGCTGGAGGAGCAGAG CCYTGGGGATTGTATCCTGMGG VP2 336 bp
MCPyV (LT3) TTGTCTCGCCAGCATTGTAG ATATAGGGGCCTCGTCAACC LT 309 bp
MCPyV (LT1) TACAAGCACTCCACCAAAGC TCCAATTACAGCTGGCCTCT LT 440 bp
Nested PCR inner primers     
KIPyV, WUPyV RTCAATTGCTGGWTCTGGAGCTGC TCCACTTGSACTTCCTGTTGGG VP2 277 bp
MCPyV (LT3) TGACGTGGGGAGAGTGTTTTTG GAGGAAGGAAGTAGGAGTCTAGAAAAG LT 155 bp
MCPyV (M1) GGCATGCCTGTGAATTAGGA TTGCAGTAATTTGTAAGGGGACT LT 179 bp
MCPyV qPCR primers TGCCTCCCACATCTGCAAT GTGTCTCTGCCAATGCTAAATGA VP1 59 bp
MCPyV probe FAM-TGTCACAGGTAATATC-MGBNFQ