Skip to main content

Table 1 Primer sequences used for RNA standard generation, cDNA synthesis and QPCR.

From: Use of a highly sensitive strand-specific quantitative PCR to identify abortive replication in the mouse model of respiratory syncytial virus disease

Primer Sequence
In vitro standard external positive sense TCCAGCAAATACACCATCCA
In vitro standard external negative sense CTGCTTCACCACCCAATTTT
In vitro standard nested positive sense ATAGAATTC GGTATGTTATATGCGATGTCTAGGT1
In vitro standard nested positive sense ATAGGATCC TGCTAAGACTCCCCACCGTAA2
Positive sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAA TCCTGCAAAAATCCCTTCAACT3
Negative sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAA ACTTTATAGATGTTTTTGTTCA3
Positive sense-specific QPCR primer CCCCACTTTATAGATGTTTTTGTTCA
Negative sense-specific QPCR primer TCCTGCAAAAATCCCTTCAACT
QPCR tag primer CGGTCATGGTGGCGAATAA
Probe FAM-TTGGTATAGCACAATCTTCTACCAGAGGTGGC-TAMRA
  1. 1 Sequence contains an EcoRI restriction site (bold, underlined)
  2. 2 Sequence contains a BamHI restriction site (bold, underlined)
  3. 3 Tag sequence is indicted (bold, underlined)