Skip to main content

Table 1 Primer and probe sequences

From: Failure to detect Xenotropic murine leukaemia virus-related virus in Chinese patients with chronic fatigue syndrome

Primer or probe Sequence (5'-3')
Gag-1S 5'-TTGGCCGGCC ACATGAGGATCACCCATGTCGTGTTCCCAATAAAGCCTTTTGCTGTTTG-3'
Gag-1A 5'-ATTCAGACGGGGGCGGGAATGTCGGCTTTGAGGGGGCCTGAGTGTCTCTGTCTCTCGTC-3'
Gag-2S 5'-GACGAGAGACAGAGACACTCAGGCCCCCTCAAAGCCGACATTCCCGCCCCCGTCTGAAT-3'
Gag-2A 5'-GAGTGATCTATGGTGGAGACATGGGTGATCCTCATGTGCCGCCTCTTCTTCATTG-3'
HCV- S 5'-CAATGAAGAAGAGGCGGCACATGAGGATCACCCATGTCTCCACCATAGATCACTC-3'
HCV-A 5'-CCTTAATTAA ACATGGGTGATCCTCATGTGGTTGGTGTTACGTTTGGTT-3'
Gag-3S 5'-GGACTTTTTGGAGTGGCTTTGTT-3'
Gag-3A 5'-GCGTAAAACCGAAAGCAAAAAT-3'
Gag p FAM5'-ACAGAGACACTTCCCGCCCCCG-3'BHQ
IC p HEX5'-CAGGCCCCCTCAAAGCCGACAT-3'BHQ
β-actin A 5'-CCTGGCACCCAGCACAAT-3'
β-actin S 5'-GCTGATCCACATCTGCTGGAA-3'
β-actin p FAM5'-ATCAAGATCATTGCTCCTCCTGAGCGC-3'TAKARA
  1. Fse I and Pac I restriction enzyme sites are underscored; a C-variant pac site is indicated by boldface type. The broken line indicates the internal control sequences inserted in the CIC. FAM: 6-carboxyfluorescein; HEX: 6-carboxyhexachlorofluorescein; BHQ: Black hole quencher dye.