Skip to main content

Table 1 Overlapping prediction of siRNA target sites found within HBV PRE by different bioinformatics tools.

From: Identification of an effective siRNA target site and functional regulatory elements, within the hepatitis B virus posttranscriptional regulatory element

Programme Position Sequence GC (%) Specificity (similarity %) Position base preference Reference
      A3* T10* Non G13* A19*  
siExplorer 1324-1343 CAUCGGAACUGACAAUUCU 42.1 - 73% match ARP6 actin-related protein 6 homolog transcript1
- 79% match chromosome x genomiccontig2 		T T C T [40]
  1640-1659 UGCCCAAGGUCUUACAUAA 42.1 - 74% match DIX domain containing 1 transcript1
- 100% match chromosome X genomic contig2 		C T T A  
  1641-1660 GCCCAAGGUCUUACAUAAG 47.3 - 73% match DIX domain containing 1 transcript1
- 95% match chromosome X genomic contig2 		C C A G  
siDirect 1344-1366 TCGTCCTCTCGCGGAAATATACA 52 - 66% match oligophrenin 1 (OPHN1) transcript1
- 71% chromosome 16 open reading frame 352 		G C G A [41]
siRNA target designer 1346-1364 GTCCTCTCGCGGAAATATA 47 - 73% match oligophrenin 1 (OPHN1) transcript1
- 74% match hypothetical protein LOC7289752 		C C A A [42]
  1321-1339 GCTCATCGGAACTGACAAT 47 - 74% ma1tch tetraspanin 7 (TSPAN7) transcript1
- 84% match chromosome 13 contig2 		T A T T  
Reynolds
et al (2004) 		1317-1337* AAAGCTCATCGGAACTGACAA 42 - 66% match tetraspanin 7 (TSPAN7) transcript1
- 81% match chromosome 2 genomic contig2 		A C A C [22]
  1318-1338 AAGCTCATCGGAACTGACAAT 42 - 66% match tetraspanin 7 (TSPAN7) transcript1
- 95% match chromosome 17 genomic contig2 		G G A A  
  1329-1349* AACTGACAATTCTGTCGTCCT 42 - 76% match zinc finger protein 559 (ZNF559) transcript1
- 76% match chromosome 19 genomic contig2 		C T T C  
  1336-1356 AATTCTGTCGTCCTCTCGCGG 52 - 71% match F-box and leucine-rich repeat protein 15 transcript1
- 81% match chromosome 20 genomic contig2 		T G C C  
  1357-1377 AAATATACATCGTTTCCATGG 33 - 62% match ADAM metallopeptidase domain 12 (ADAM12) transcript1
- 76% match chromosome 11 genomic contig2 		A T T T  
  1358-1378 AATATACATCGTTTCCATGGC 42 - 67% match bactericidal/permeability increasing protein-like 2 (BPIL2)1
- 76% match chromosome 11 genomic contig2 		T C T G  
  1. Predicted siRNA target sites from siExplorer, siRNA target design and Reynolds et al. (2004) [22] were found to have overlapped regions. Bold indicates the position base preference. '*' indicates the selected siRNA target sites, '1' and '2' indicate the best matches from the blastn search against human transcript and genomic databases respectively. Details of the blastn matches are in additional file 1.
Back to article page

Virology Journal

ISSN: 1743-422X