Skip to main content

Table 1 Summary of primers used

From: Phylogenetic analyses of the polyprotein coding sequences of serotype O foot-and-mouth disease viruses in East Africa: evidence for interserotypic recombination

Primer ID Primers Fragment/Primer combination
8-A PN 2 GTCNCCTATTCAGGCNTAGAAG Fragment 1: 8-A PN-35 & 8-A PN-2
8-A PN 3 GGCTAAGGATGCCCTTCA  
8-A PN 4 AACCAGTCNTTCTTNTGNGTG Fragment 2: 8-A PN 3 & 8-A PN-4
8-A PN 6 CCNGTNNACATGAANTGCAGGTT  
8-A PN 14 ATCTCNAACTCAAACACTCTG Fragment 3: 8-A PN 34 & 8-A PN-83
8-A PN 22 AAGGACCCNGTCCTTGTGGC  
8-A PN 23 CCGTCNAAGTGGTCAGGGTC Fragment 4: 8-A PN 51 & 8-A PN-6
8-A PN 34 ATGGACACNCAGCTTGGTGAC  
8-A PN 35 GAGAAANGGGACGTCNGCGC Fragment 5: 8-A PN 84 & 8-A PN-85
8-A PN 45 GGAAGAAACTCGAGGCGAC  
8-A PN 46 TGGTCGTTTGCCTCCGTGG Fragment 6: 8-A PN 98 & 8-A PN-64
8-A PN 51 CCACAGATCAAGGTGTATGC  
8-A PN 64 GGTTGGACTCCACATCTCC Fragment 7: 8-A PN 86 & 8-A PN-45
8-A PN 68 GGGTCCTTCAGCTGGTGG  
8-A PN 80 GGAGTGTTTGGCACTGCC Fragment 8: 8-A PN 22 & 8-A PN-23
8-A PN 83 CTTTGGAAGGGAACTCACC  
8-A PN 84 TACTACACCCAGTACAGCG Fragment 9: 8-A PN 46 & 8-A PN-87
8-A PN 85 TGCAGCTTCGGGTGCTCC  
8-A PN 86 GGCCATCCACCCGAGTG Fragment 10: 8-A PN 99 & 8-A PN-68
8-A PN 87 CTCAAAGAATTCAATTGCTGC  
8-A PN 98 GCATCCACTTACTACTTTGC Fragment 11: 8-A PN 113 & 8-A PN-14
8-A PN 99 TGTACCANCTTGTTNANGAGGTG  
8-A PN 101 CAGGGTTGAACACACCGAG Fragment 12: 8-A PN 80 & 8-A PN-101
8-A PN 113 CGCGANACTCGCAAGAGAC