Skip to main content

Table 1 Details of the primers used for PCR amplification in the study.

From: Molecular characterization of Chikungunya virus isolates from clinical samples and adult Aedes albopictus mosquitoes emerged from larvae from Kerala, South India

Primer Name Sequence (5'→3'); location with respect to S27 sequence (GenBank Accession AF369024) Target Ta
(°C)
Amplicon size Reference
RT PCR for CHIKV detection in patient and adult mosquitoes derived from larvae
E1 F tacccatttatgtggggc (10246-10263)   52 294bp [16]
E1 R gcctttgtacaccacgatt (10539-10521) E1    
NSP2F tgccatgggaataatagagactccg (1682-1699)     
ChR6 gcgagtcaaccgtacgtgcag (2390-2370) nsP2 55 709bp This study
ChF27 gtcccctaagagacacattg (11486-11505)     
ChR28 tacgtccctgtgggttcggagaat (11798-11780) 3'NTR 52 313bp [14]
RT PCR of partial sequences CHIKV genes for sequencing and phylogenetic analysis
E1Fseq1 gctccgcgtcctttacc (10389-10405)     
E1Rseq1 atggcgacgcccccaaagtc (10943-10924) E1 55 555bp This study
ChF21 gggacacttcatcctggc (8832-8849)     [14]
ChR22 acatttgccagcggaaac (9332-9315) E2 55 501bp  
ChF8 cctatcctcgaaacagcg (3134-3151)     [14]
ChR9 gtgactctcttagtaggc (3636-3619) nsP2 45 503bp