Skip to main content

Advertisement

Table 8 Sequences of oligonucleotides used for detection of viruses in the study

From: Respiratory viral infections detected by multiplex PCR among pediatric patients with lower respiratory tract infections seen at an urban hospital in Delhi from 2005 to 2007

Target gene Primer Position (nucleotide) Sequence (5' to 3') Amplicon size
RSV N gene RSVNF 52–71 bp relative to RSV A (U39961) and RSV B (AF013254) CTGTCATCCAGCAAATACAC 683 bp
  RSVNR 711–734 bp relative to RSV A (U39961) and RSV B (AF013254) ACCATAGGCATTCATAAACAATC  
PIV1 N gene PIV1NF 64–89 bp primer location was relative to NC003461, Washington 1964 strain (Osiowy C 1998) TCTGGCGGAGGAGCAATTATACCTGG 84 bp
  PIV1NR 122–147 bp primer location was relative to NC003461, Washington 1964 strain (Osiowy C 1998) ATCTGCATCATCTGTCACACTCGGGC  
PIV2 N gene PIV2NF 221–242 bp primer location was relative to AF533012, Greer strain GATGACACTCCAGTACCTCTTG 197 bp
  PIV2NR 395–416 bp primer location was relative to AF533012, Greer strain GATTACTCATAGCTGCAGAAGG  
PIV3 N gene PIV3NF 439–465 bp primer location was relative to D10025 strain GATCCACTGTGTCACCGCTCAATACC 266 bp
  PIV3NR 680–705 bp primer location was relative to D10025 strain CTGAGTGGATATTTGGAAGTGACCTGG  
hMPV N gene hMPVNF 79–104 bp primer location was relative to hMPV 00–1 (AF371337) strain (Banerjee et al., 2007) AAGCATGCTATATTAAAAGAGTCTCA 440 bp
  hMPVNR 496–518 bp primer location was relative to hMPV 00–1 (AF371337) strain (Banerjee et al., 2007) ATTATGGGTGTGTCTGGTGCTGA  
RSV N gene (nested primers) RSVAF 156–180 bp primer location was relative to RSV A (U39961) strains AAGCAAATGGAGTGGATGTAACAAC 260 bp
  RSVAR 532–554 bp primer location was relative to RSV A (U39961) strains CTCCTAATCACAGCTGTAAGACCCA  
  RSVBF 135–160 bp primer location was relative to RSV B (AF013254) strain CAAACTATGTGGTATGCTATTAATCA 328 bp
  RSVBR 463–486 bp primer location was relative to RSV B (AF013254) strain ACACAGTATTATCATCCCACAGTC  
Influenza A matrix gene Inf AF 119–140 bp primer location was relative to NC003150 (A/New Caledonia/20/99) and NC032261 (A/Panama/2007/99) AGGYWCTYATGGARTGGCTAAAG 105 bp
  Inf AR 204–223 bp primer location was relative to NC003150 (A/New Caledonia/20/99) and NC032261 (A/Panama/2007/99) GCAGTCCYCGCTCASTGGGC  
Influenza B matrix gene Inf BF 54–76 bp primer location was relative to CY018638 strain GGAGAAGGCAAAGCAGAACTAGC 503 bp
  Inf BR 531–554 bp primer location was relative to CY018638 strain CCATTCCATTCATTGTTTTTGCTG  
GAPDH primers GAPDH1 Gueudin et al., 2003 TCA TCC ATG ACAACT TTG GTA TCG TG 564 bp
  GAPDH1 Gueudin et al., 2003 CTC TTC CTC TTG TGCTCT TG  
  1. Y, W, R, S are wobbles for C/T, A/T, A/G and G/C