Skip to main content

Advertisement

Table 5 Oligonucleotides used to amplify the NA, HAt and P1 genes

From: Identification and characterisation of a novel anti-viral peptide against avian influenza virus H9N2

Primers Sequence
pY-NA-Fa 5' CATAGAATTCGCAAAAGCAGGAGT 3'
pY-NA-R 5' TATCGCTCGAGAGTAGAAACAAGGAG 3'
pY-HAt-F 5' ATTTAAGGTACCGACAGCCATGGA 3'
pY-HAt-R 5' ATGCTGCTCGAGTATACAAATGTTGC 3'
pH-P1-F 5' AGCCTGGAATTCATGAAAAAATTA 3'
pH-P1-R 5' ATCGAACTCGAGATTTTCAGGGAT 3'
pHybLex/Zeo-F 5' AGGGCTGGCGGTTGGGGGTTATTCGC 3'
pHybLex/Zeo-R 5' GAGTCACTTTAAAATTTGTATACAC 3'
pYESTrp2-F 5' GATGTTAACGATACCAGCC 3'
pYESTrp2-R 5' GCGTGAATGTAAGCGTGAC 3'
pC-HA-F 5'ATTTAAGGATCCGAGAGCCATGGA 3'
pC-HA-R 5'ATGCTGCTCGAGTTATATACAAATGTTGC 3'
pC-NA-F 5'CATAGAATTCGCAAAAGCAGGAGT 3'
pC-NA-R 5'TATCGCTCGAGAGTAGAAACAAGGAG 3'
pC-P1-FP 5'AGCCTGGAATTCATGAAAAAATTA 3'
pC-P1-RP 5'CTCACTCGAGACATTTTCAGGGA 3'
  1. aIn all of the above mentioned oligonucleotides, the suffixes F and R refers Forward and Reverse primers respectively