Skip to main content

Table 1 Primers used to generate expression constructs

From: Hepatitis C virus NS4B carboxy terminal domain is a membrane binding domain

NS4B FL
Forward primer, GTGGGTACCATGTCACACCTCCCTTACATCGAACAG
Reverse primer, TAGTCTAGAGAGCCGGAGCATGGCGTGGAGCAGTC
NS4B-CTD
Forward primer, GTGGGTACCATGGCGATACTGCGTCGGCACGTGGGC
Reverse primer, as NS4B FL
NS4B-deltaCTD
Forward primer, as NS4B FL
Reverse primer, TAGTCTAGAGACCGACGCAGTATCGCTGCGCACACGAC
NS4B-CTD sub-Cys
Forward primer, as for NS4B-CTD
Reverse primer, AGATCTAGAGAGCCGGAGGATGGCGTGGAGGAGTCCTCGTTGATCCACTG
d-LDH MBD
Forward primer, GTGGGTACCATGAAATACGGCAAAGACACCTTCC
Reverse primer, TACTCTAGAGAATGCTCGTATTTATCGC