Skip to main content

Table 1 Primers used in this study

From: Interaction of influenza virus NS1 protein with growth arrest-specific protein 8

Purpose Primer sequence (5'-3')
  Forward Reverse
NS1
pSos
CGGTCGACGATGGATTCCAACACTGTGT ACGTGCGGCCGC ATCAGCCATCTTATCTCTTC
NS1
pCMV-Myc
ACGCGTCGACCATGGATTCCAACACTGTGTC TTGCGGCCGC TCAATCAGCCATCTTATCTC
NS1
pEGFP-N3
CCGAATTCTATGGATTCCAACACTGTGTC GGGGTACC ATCAGCCATCTTATCTCTTC
NS1
pGEX-6P-1
CCGAATTCATGGATTCCAACACTGTGTC TTGCGGCCGC TCAATCAGCCATCTTATCTC
NS11-80
pCMV-Myc
ACGCGTCGACC ATGGATTCCAACACTGTGTC TTGCGGCCGC TCAGGTCATTGTAAGCGCCTC
NS181-238
pCMV-Myc
ACGCGTCGACC ATGGCCTCCACACCTGC TTGCGGCCGC TCAATCAGCCATCTTATCTC
GAS8 pDsRed-Express-C1 GGAATTCGATGGCACCGAAAAAGAAAGGGAAGA GGGGTACCCGTCGGGGTGCCCACCAGTCCCGC
GAS8
pCMV-Tag 2B
CGGAATTCATGGCACCGAAAAAGAAAGGGAAGA CCCTCGAGTTACGTCGGGGTGCCCACCAGTCC
GAS81-260
pCMV-Tag 2B
CGGAATTCATGGCACCGAAAAAGAAAGGGAAGA CCCTCGAGTTACTTCCGCATGTCCTCCATCTG
GAS8260-478
pCMV-Tag 2B
CGGAATTCAAGGAGGACCACCTGGAGAGGG CCCTCGAGTTACGTCGGGGTGCCCACCAGTCCCGC