Skip to main content

Table 3 Oligonucleotide primers used for RT-PCR amplification and nucleotide sequencing.

From: The Asia 2 specific signal peptide region and other domains in fusion protein genes characterized Asia 1 and Asia 2 canine distemper viruses

Name Sequence (5' - 3')a Nucleotide position Region
4754F ACTTGCCCGATCTCAAGCTA 4754-4773 M-F
5211F AGTGTCTCAAAAGGAGCGAG 5211-5230 F gene
07-5379F GGACCGACAGTGTCCATTAT 5380-5399  
5645F GGCTACAGCTGCACAAATCA 5645-5664  
6210F ACTGTCCCGAGGTATGTTGC 6210-6229  
6751F TTGGCAGTCTCCTCAGTGTT 6751-6770  
CDV-HS1 AACTTAGGGCTCAGGTAGTCC 7054-7074 H gene
7661F GTAGGCAAAGTTTTCCCCCT 7661-7680  
cdvhf1 TGTGTGTAGAAGAGAGCACTGT 7962-7983  
8691F TTTATGACCCAATCCGGACG 8691-8710  
CDVHS2 ATGCTGGAGATGGTTTAATTCAATCG 8969-8994 H-L
  1. a Forward and reverse primers in italic used for RT-PCR.