Skip to main content

Table 1 Selected primers for the OPV/PPV nested-multiplex PCR

From: Nested-multiplex PCR detection of Orthopoxvirus and Parapoxvirus directly from exanthematic clinical samples

Genus Target gene   Primer sequence (5' - 3') Reference
OPV vgf 1st step vgfF: CGCTGCTATGATAATCAGATCATT Fonseca et al., 1998
    vgfR: GATATGGTTGTGCCATAATTTTTAT  
   Nested step vgfF2: ACACGGTGACTGTATCCA This study
    vgfR2: CTAATACAAGCATAATAC  
PPV b2l 1st step OVB2LF1: TCCCTGAAGCCCTATTATTTTTGT Hosamani et al., 2006
    OVB2LR1: GCTTGCGGGCGTTCGGACCTTC  
   Nested step PPP-1: GTCGTCCACGATGAGCAG Inoshima et al., 2000
    PPP-4: TACGTGGGAAGCGCCTCGCT