Skip to main content

Table 4 Primers used in reverse transcription and amplification of portions of the S and M segments of Sin Nombre virus genotypes

From: Temporal and geographic evidence for evolution of Sin Nombre virus using molecular analyses of viral RNA from Colorado, New Mexico and Montana

PCR step SNV segment Primer name Sequence
RT S SNV-S5'T TAGTAGTAGACTTCKTRAAGAGCTACT
1° reaction S SNV-S41s GGAATGAGCACCCTCAAAGAAGTGCAAGACAAC
1° reaction S PSE-S1064r ATRGTRTTYCTCATATCCTG
2° reaction S SNV-S143s TGGACCCMGATGAYGTTAACAA
2° reaction S SNV-S1000r GACAYCGATCWGGNGCACATGCAAARACCC
RT M SNV-M2730s CTTTTAGAAAGAWMTGTGSRTTTGC
1° reaction M SNV-M2730s CTTTTAGAAAGAWMTGTGSRTTTGC
1° reaction M SNV-M3023r CCTACTCCTGAACCCCAGGCCCCG
2° reaction M SNV-M2764s CCAACATGTGAGTATCAAGGCAACACAGTGCTGG
2° reaction M SNV-M2966r GGKKTWTCACTTAGRTCYTGRAAGG