Skip to main content

Advertisement

Table 3 Oligonucleotide primers used for amplification of LASV genes expressed in E. coli

From: Bacterial-based systems for expression and purification of recombinant Lassa virus proteins of immunological relevance

LASV Gene Amplified LASV Primer Oligonucleotide Primer Sequence
GP1 5' GP1 bac TTTCAGAATTCGGATCC ACCAGTCTTTATAAAGGGGTTTAT
GP1 3' GP1 bac GGTACCAAGCTT TCA GTCA TAGCAATCTTCTACTAATATAAATATCTCT
GP2 5' GP2 bac TTTCAGAATTCGGATCC GGCACATTCACATGGACACTG
GP2 3' GP2 bac GGTACCAAGCTT TCA GCTA TGTCTTCCCCTGCCTCTCCAT
NP 5' NP bac TTTCAGAATTC AGTGCCTCAAAGGAAATAAAATCCTTTTTGTGGACACAATCTTTGAGGAGGGAATTATCTGGTTAC
NP 3' NP bac GGTACCAAGCTT TCA GTTA CAGAACGACTCTAGGTGTCGATGT
  1. Note. REN sites are underlined, and stop codons (TCA, CTA, TTA) are in bold print.