Skip to main content

Table 1 Primers used in TULV isolate-specific RT-PCR assays.

From: Tula hantavirus isolate with the full-length ORF for nonstructural protein NSs survives for more consequent passages in interferon-competent cells than the isolate having truncated NSs ORF

Primer name (isolate, segment, forw/rev) Sequence 5'-3' Position (nt) Amplicon size (bp)
LVSF783 (Lodz, S, forw) GAAAAAGCAAGGTGGTCCCAAC 783–804 266
LVSR1026 (Lodz, S, rev) GGATTGAGAAGAAGGCTCCTAAT 1026–1048  
LodzG2F426 (Lodz, M, for) CAAATTGAGGTCAGTCGGG 426–444 528
LodzG2R953 (Lodz, M, rev) AATGATAAATCCCTATTGACG 933–953  
LodzG2F554 (Lodz, M, nested PCR, forw) CCGTTAAAGTTTGCATGATAGGG 554–576 261
LodzG2R814 (Lodz, M, nested PCR, rev) GTTGATAGCCAGAAACTGTATTG 792–814  
TulSF895 (Moravia, S, forw) GATTGATGACTTGATTGATCTTGC 895–918 255
MVSR1149 (Moravia, S, rev) GCGTCTCAGATATGACTGATAG 1128–1149  
MorG2F83 (Moravia, M, forw) CTGATTTAGAATTGGATTTTTCCC 83–106 735
MorG2R817 (Moravia, M, rev) TTCTCTGATATCCAGATACAGTG 795–817  
MorG2F444 (Moravia, M, nested PCR, forw) CAAAGTTTATAAAATCCTGTCCC 444–466 136
MorG2R579 (Moravia, M, nested PCR, rev) TGTTCCAATCATACAGACCTTC 558–579