Skip to main content

Advertisement

Table 1 Primers for detection of TYLCV in infected plants, sequencing of TYLCV clones, and relative quantification of TYLCV with quantitative PCR (Q-PCR)

From: A novel cloning strategy for isolating, genotyping and phenotyping genetic variants of geminiviruses

Primer code Primer sequence Final concentration used
Detection of TYLCV with PCR (600 bp amplicon)
Ty 2353+ CTGAATGTTTGCATGGAAATGTGC 200 nM
Ty321- GGTCGCTTCGACATARTCACG 200 nM
Sequencing of TYLCV cloned sequences
pGreen1589 (+) CACGACGTTGTAAAACGACG  
pG1825(-) CACAGGAAACAGCTATGACC  
579 (+) GATGTTACTCGTGGATCTGG  
1141 (+) CATGATCAACTGCTCTGATTAC  
1741(+) GGGCTTCCCGTACTTTGTG  
2321(+) TGGATTTAGCTCCCTGAATG  
TYLCV primers for Q-PCR (176 bp amplicon)
Ty 2164+ CTAAGAGCCTCTGACTTACTGC 200 nM
Ty 2339- AACATTCAGGGAGCTAAATCCAG 200 nM
Actin2 gene primers for Q-PCR (148 bp amplicon)
Act 1+ CCCRGAGGTHCTCTTCCARC 200 nM
Act 148- TMCGRTCAGCAATACCAGGG 200 nM