Skip to main content

Table 1

From: Carlow Virus, a 2002 GII.4 variant Norovirus strain from Ireland

Primer Sequence Polarity Ref
JV12 ATACCACTATGATGCAGATTA (4279–4299) + [28]
SM31 CGATTTCATCATCACCATA (4592–4610) - [28]
COG2F CARGARBCNATGTTYAGRTGGATGAG (5003–5028) + [19]
G2NVR ACCNGCATANCCRTTRTACATTC (5365–5387) +  
TX30SXN GACTAGTTCTAGATCGCGAGCGGCCGCCC (T × 30) - [29]
ORF3minusdegen ATCTCCTTRTCATGWTTRAARGAAGCC (6868–6894) -  
430F ATGTGGGAYGGRGAGATCTAC (398–418) +  
4440 minus TCGTTGATTGATATTGTGAAGTC (4436–4458) -  
4440 nest TTGATTGATATTGTGAAGTC (4436–4455) -  
5090 R TCATTCGACGCCATCTTCATT (5084–5104) -  
4290 F TCACTATGATGCTGATTACTC (4282–4302) -  
NLV1S25F GTGAATGAAGATGGCGTCTAACGAC (1–25) +  
NEWRACE ATAGCAATTGTTGTCAAAGGCTGTGTAAGGGAACG (588–622) -