Skip to main content

Table 1 Oligonucleotide probe sequences used in this study.

From: Detection of virus mRNA within infected host cells using an isothermal nucleic acid amplification assay: marine cyanophage gene expression within Synechococcus sp

  Cyanophage target
  S-PM2 g20 coding strand S-PM2 g20 non-coding strand
Extension probe TGACCATCGTAAACAAGCTT
GTTTCTGTATTCGAAAT
AACAATACTTGCGTGATGTAAT
GTCACGTTTTCGAAAT
Template probe TCGTCTTCCGGTCTCTCCTCT
CAAGCCTCAGCGCTCTCTCTC
CCTATAGTGAGTCGTATTAATT
TCGAAhACGTGACATTACATCA
CGCAAGTATTGTTx
TCGTCTTCCGGTCTCTCCTCTCA
AGCCTCAGCGCTCTCTCTCCCT
ATAGTGAGTCGTATTAATTTCGA
AhACAGAAACAAGCTTGTTTACG
ATGGTCAAx
Facilitator 1 TGCTTTTTATCATCACGAATC
TCTCCTGTTx
ATGTTGGTAATCTACCAAAGGTA
AAGGCAGx
Facilitator 2 CTGCCTTTACCTTTGGTAGA
TTACCAACAx
ACAGGAGAGATTCGTGATGATAA
AAAGCATx
  1. All sequences are written (5' → 3').
  2. S-PM2 GenBank accession number AF016384.
  3. h Indicates position of hexaethylene glycol linker molecule.
  4. x Indicates position of phosphorylation to prevent extension.
  5. Oligonucleotides used for further amplification and detection of the RNA signal are described in Hall et al. [4].