Skip to main content

Table 1 Table 1

From: Recombination-ready Sindbis replicon expression vectors for transgene expression

Oligo Sequence
BG31 5' ATATACGCGTTGACATTGATTATTGACTAG
BG32 5' GGTAACAAGATCTCGTGCCG
BG33 5' GGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGATTGACGG CGTAGTACACACTATTGAATCAAACAGCCG
BG34 5' CGGCTGTTTGATTCAATAGTGTGTACTACGCC GTCAATCGGTTCACTAAACGAGCTCTGCTTATATAGACCTCCC
BG35 5' GGCACGAGATCTTGTTACCAGCGG
BG36 5' TGTCCATACTAGTAATAGAGTTGTCC
BG37 5' GGACAACTCTATTACTAGTATGGACAG
BG38 5' CTGACTAATACTACAACACCACCACCATGGCCAAGCCTTTGTCTCAAG
BG39 5' TTGAGACAAAGGCTTGGCCATGGTGGTGGTGTTGTAGTATTAGTCAG
BG40 5' CCCTCTGGTTATGTGTGGGAGGGCTAACGGGCCCAGGTAGACAATATTACACC
BG41 5' GGTGTAATATTGTCTACCTGGGCCCGTTAGCCCTCCCACACATAACCAGAGGG
BG42 5' GGCGCCAGCGAGGAGGCTGGGACCATGCCGGCCTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTGAAATGTTAAAAACAAAATTTTG
BG43 5' ATTACCGAGGGGACGGTCCCCTCGGAATGTTGCCCAGCCG GCGCCAGCGAGGAGGCTGGGACCATGCCGGCC
BG44 5' GCCCGCTAGCCTCGAGGAATTCCCGTCCCATTCGCCATTACCGAGGGGACGGTCCCC
BG115 5' CATGAAGCTTATGAATAGAGGATTCTTTAACATGCTCG
BG116 5' CTACCTGGGCCCGTCATCTTCGTGTGCTAGTCAGC
BG121 5' CATGGCTAGCACAAGTTTGTACAAAAAAGCTGAACG
BG122 5' CATGGCTAGCACCACTTTGTACAAGAAAGCTGAACG
BG155 5' GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAAGGAGATAGAACCATGGGGATGCA TGGTACCATGGTGAGCAAGG
BG156 5' GGGGACCACTTTGTACAAGAAAGCTGGGTTTACTTGTACAGCTCGTCCATGCCG
BG162 5' TTGGGGCGTAGCGTCTAGGATCCATG
BG256 5' GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAAGGAGATAGAACCATGGCCTCAAAG CCAGTCCTGAGCACG
BG258 5' GGGGACCACTTTGTACAAGAAAGCTGGGTCTAATGGTGATGGTGATGATGACCG
BG192 5' TCTGGTTATGTGTGGGAGGGC
BG209 5' GGCCAAGATCTTTTCTTGCTGGTTCTCTTGTACAGCTCGTCCATGCCG