Skip to main content

Table 1 Codon optimized sequences of mutagenesis primers

From: Characterization of neutralizing epitopes within the major capsid protein of human papillomavirus type 33

Constructs Sequences for primers (listed 5' to 3')
HPV33:BC For GGCCATCCATATTTTCCCATCAAGAAGCCCAACAACAACAAATTATTGGTACCC
  Rev GGGTACCAATAATTTGTTGTTGTTGGGCTTCTTGATGGGAAAATATGGATGGCC
HPV33:DE For TTTGATGACATCGAAAACGCCAGCGCCTACGCCGCCAACGCCGGTGCTGATAATAGG
  Rev CCTATTATCAGCACCGGCGTTGGCGGCGTAGGCGCTGGCGTTTTCGATGTCATCAAA
HPV33:FGa For ATGTTTGTAAGACACCTGTTCAACAGGGCCGGCGCCTACGGCGAGAACGTTCCCGATGACCTG
  Rev CAGGTCATCGGGAACGTTCTCGCCGTAGGCGCCGGCCCTGTTGAACAGGTGTCTTACAAACAT
HPV33:FGb For ATTAAAGGTTCAGGAAGCACCGCCAACCTGGCCAGCAGCAACTACTTTCCCACTCCTAGTGG
  Rev CCACTAGGAGTGGGAAAGTAGTTGCTGCTGGCCAGGTTGGCGGTGCTTCCTGAACCTTTAAT
HPV33:HI For AATATGACTTTATGCGCCGCCATCAGCACCAGCGAGACCACCTACAAGAACAACAATTTTAAAGAATATATAAG
  Rev CTTATATATTCTTTAAAATTGTTGTTCTTGTAGGTGGTCTCGCTGGTGCTGATGGCGGCGCATAAAGTCATATT
HPV16:BC For GGCCACCCCTACTTCAGCATCAAGAACCCCACCAACGCCAAGAAGATCCTGGTGCCC
  Rev GGGCACCAGGATCTTCTTGGCGTTGGTGGGGTTCTTGATGCTGAAGTAGGGGTGGCC
HPV16:DE For ACCGGCAACAAGTACCCCGGCCAGCCCGGCGTGGACAACAGGGAGTGCATCAGCATGGAC
  Rev CCTGTTGTCCACGCCGGGCTGGCCGGGGTACTTGTTGCCGGTCTCGGTGTCGTCCAG
HPV16:FGa For ATGTTCGTGAGGCACTTCTTCAACAGGGCCGGCACCCTGGGCGAGGCCGTGCCCGACGACCTG
  Rev CAGGTCGTCGGGCACGGCCTCGCCCAGGGTGCCGGCCCTGTTGAAGAAGTGCCTCACGAACAT
HPV16:FGb For ATCAAGGGCAGCGGCACCACCGCCAGCATCCAGAGCAGCGCCTTCTTCCCCACCCCCAGC
  Rev GCTGGGGGTGGGGAAGAAGGCGCTGCTCTGGATGCTGGCGGTGGTGCCGCTGCCCTTGAT
HPV16:HI For AACATGAGCCTGTGCACCCAGGTGGCCAGCGACAGCACCTACAAGAACGAGAACTTCAAGGAGTACCTG
  Rev CAGGTACTCCTTGAAGTTCTCGTTCTTGTAGGTGCTGTCGCTGGCCACCTGGGTGCACAGGCTCATGTT