Skip to main content

Table 1 Small interfering RNA

From: Actively replicating West Nile virus is resistant to cytoplasmic delivery of siRNA

Name Virus Start Nucleotide Target Sequence
Cap WNV Lineage I 312 gaacaaacaaacagcgatgaa
Cap-Mut WNV Lineage I 312 gaagaaagaaagaccgatgaa
M2 Influenza A M2 18 ggtcgaaacgcctatcagaaa
3110 WNV Lineage I 3110 gggcagttctgggtgaagt
3317 WNV Lineage I 3317 ctacggtcaccctgagtga
4119 WNV Lineage I 4119 gaggagcaagtctgctatgc
4823 WNV Lineage I 4823 gtgtcaaggaggatcgact
5039 WNV Lineage I 5039 gacggtgatgtgattgggct
5497 WNV Lineage I 5497 gcagcaagaggttacattt
6337 WNV Lineage II 6337 gttgaagtcatcacgaagt
6349 WNV Lineage I 6349 gtggaagtcatcacgaagc
6915 WNV Lineage I 6915 caacgagatgggttggcta
7353 WNV Lineage I 7353 gaagaacgctgtagtggat
7693 WNV Lineage I 7693 ggacgcaccttgggagaggt
8892 WNV Lineage I 8892 ggtcaacagcaatgcagct
8898 WNV Lineage I 8898 cagcaatgcagctttgggt
9095 WNV Lineage I 9095 gaagcagagccatttggtt
9607 WNV Lineage I 9607 gggaaaggacccaaagtca
10355 WNV Lineage I 10355 gagagatatgaagacacaac
  1. siRNA were generated against 19–21 nucleotide sequences corresponding to the target region of different parts of the New York 1999 WNV genome. Sequences were chosen using the SciTools RNAi design program and compared against the GenBank database to exclude sequences that may affect cellular genes.
Back to article page