Advertisement
Table 1 Small interfering RNA
From: Actively replicating West Nile virus is resistant to cytoplasmic delivery of siRNA
| Name | Virus | Start Nucleotide | Target Sequence |
|---|---|---|---|
| Cap | WNV Lineage I | 312 | gaacaaacaaacagcgatgaa |
| Cap-Mut | WNV Lineage I | 312 | gaagaaagaaagaccgatgaa |
| M2 | Influenza A M2 | 18 | ggtcgaaacgcctatcagaaa |
| 3110 | WNV Lineage I | 3110 | gggcagttctgggtgaagt |
| 3317 | WNV Lineage I | 3317 | ctacggtcaccctgagtga |
| 4119 | WNV Lineage I | 4119 | gaggagcaagtctgctatgc |
| 4823 | WNV Lineage I | 4823 | gtgtcaaggaggatcgact |
| 5039 | WNV Lineage I | 5039 | gacggtgatgtgattgggct |
| 5497 | WNV Lineage I | 5497 | gcagcaagaggttacattt |
| 6337 | WNV Lineage II | 6337 | gttgaagtcatcacgaagt |
| 6349 | WNV Lineage I | 6349 | gtggaagtcatcacgaagc |
| 6915 | WNV Lineage I | 6915 | caacgagatgggttggcta |
| 7353 | WNV Lineage I | 7353 | gaagaacgctgtagtggat |
| 7693 | WNV Lineage I | 7693 | ggacgcaccttgggagaggt |
| 8892 | WNV Lineage I | 8892 | ggtcaacagcaatgcagct |
| 8898 | WNV Lineage I | 8898 | cagcaatgcagctttgggt |
| 9095 | WNV Lineage I | 9095 | gaagcagagccatttggtt |
| 9607 | WNV Lineage I | 9607 | gggaaaggacccaaagtca |
| 10355 | WNV Lineage I | 10355 | gagagatatgaagacacaac |
