Skip to main content

Table 1 Sequence of oligonucleotide primers used for reverse transcription, PCR, and sequencing of SIV.

From: Development and characterization of positively selected brain-adapted SIV

Primer Sequence
Reverse Transcription
SIVGSP TGCTAGGGATTTTTCCTGCYTCGGTTT
Nested PCR
6516 CTCGCTTGCTAACTGCA CTTCTAATCATATCTA
Sph2 GCATGCTATAACACATGCTATTGTAAAAAGTGTT
10505 AAGCAGAAAGGGTCCTAACAGACCAGGGTCTTCA
Molecular Clone Sequencing
For 1 AACTCAGTGCCTACCAGATAA
For 2 TGGCATGGTAGGGATAATAGGA
For 3 ATAAAAGAGGGGTCTTTGTGCT
For 4 AACTGCAGAACCTTGCTATCG
For 5 GTTTGATCCAACTCTAGCCTACAC
For 6 ATGACAGGGTTAAAAAGAGACAAGA
For 7 GAATTGGTTTCTAAATTGGGTAGA
For 8 GAGGCACAAATTCAACAAGAGAAG
For 9 CATACAGAAAACAAAATATGGATGA
For 10 TCCTGGTCCTGAGGTGTAATCCTG
Rev 1 CGCAAGAGTCTCTGTCGCAGAT
Rev 2 AGAGGGTGGGGAAGAGAACACTG
Rev 3 ACTTCTCGATGGCAGTGACC
Rev 4 CCAGACATAATGGAGACTGGTAA
Rev 5 AGAGTACCAAGTTTCATTGTACTC
Rev 6 AGGCAAATAAACATTTTTGCCTAC
Rev 7 GAGCGAAATGCAGTGATATTTATACATCAAG
Population PCR and Sequencing
8877For ATAGCTGGGATGTGTTTGGC
8534For GCTGGGATAGTGCAGCAACAGCAAC
8406For CTACTGGTGGCACCTCAAG
9452Rev CGAGTATCCATCTTCCAC
9625Rev CCTACCAAGTCATCATCTTCCTCA
9880Rev ATCCTCCTGTGCCTCATCTG
10203Rev ATCAAGAAAGTGGGCGTTCCCGACC