Figure 6From: Porcine circovirus type 2 in China: an update on and insights to its prevalence and controlGenome maps of eight PCV2-like agents. For P1, twenty-two nucleotides (GGATCCACTAGTAACGGCCGCC) from 5'-terminal region might originate from porcine endogenous retroviruses and the rest of the sequence shared 98.42% identity with ORF2 of PCV2 genome (AF381175). For P2, its ORF3 sequences shared 64.7% ~ 97.4% identity with ORF2 of PCV genome. For JSTZ, ZJQDH1 and ZJQDH2, online Blastn results showed they shared hightest nucleotide identity (98% ~ 100%) with the partial sequences of PCV2 (the strain of GZ-CS1, JQ809462). For JSHM, online Blastn results showed it shared hightest nucleotide identity (98% ~ 100%) with the partial sequences of PCV2 (the strain of CQWZ12, KF742551). For CH-IVT1, online Blastn results showed it shared hightest nucleotide identity (100%) with the partial sequences of PCV2 (the strain of BF, AF381175). For BIV, online Blastn results showed it shared hightest nucleotide identity (99%) with the partial sequences of PCV2 (the strain of 10JS-2, JQ806749). Note: Complete genomes of P1 and P2 were showed in reference [78] and reference [76], respectively.Back to article page