Skip to main content

Table 3 Primers used for amplifying genes encoding Brucella proteins

From: Influenza viral vectors expressing the Brucella OMP16 or L7/L12 proteins as vaccines against B. abortus infection

Gene Primer Sequence
Omp16 (GenBank ID: AAA59360) omp16-f 5′- CGCAT ATG CGCCGTATCCAGTCGATTGCA -3′
omp16-r 5′- CGCTCGAG CCTTCCGGCCCCGTTGAGAA -3′
L7/L12 (GenBank ID: AAA19863.1) L7/L12-f 5′-CGCAT ATG GGAATTTCAAAAGCAAGTCT-3′
L7/L12-r 5′-CGCTCGAG GCGCGACAGCGTCACGGCCT-3′
  1. Restriction sites are bold-faced, and start codons are shown in italics.