Skip to main content

Table 1 Primers and probe

From: Characterization of small ruminant lentivirus A4 subtype isolates and assessment of their pathogenic potential in naturally infected goats

Assay Gene Primer name Sequence Orientation Position* Product length Annealing temperature PCR round
Seminested env 563 GAYATGRYRGARCAYATGAC Forward 7272-7291 818 bp 47°C 1
PCR   564 GCYAYATGCTGIACCATGGCATA Reverse 8067-8089 818 bp 47°C 1
   567 GGIACIAAIACWAATTGGAC Forward 7482-7502 608 bp 49°C 2
   564 GCYAYATGCTGIACCATGGCATA Reverse 8067-8089 608 bp 49°C 2
PERT assay   MS2-5R TGTAAGCCTGTGAACGCGAG Reverse 1464    
   MS2-4f CCGTATGGCCAACAACTGG Forward 1214    
   MS2-P45 AGAGCCCTCAACCGGAGTTTGAAGCA Probe 1310    
Quantitative env WasJam-F ATGCCACAATCCTATATTCAAAATC Forward 7833-7855    
Real time PCR   WasJam-R GCTGCCTCTAACACTTGCTG Reverse 8046-8065    
   WaJaRealTP TGCTTGCTATCATGGCT Probe 7927-7943    
  1. Table 1 present a list of the different primers and the probe used for the seminested PCR in the env region, the PERT assay and the quantitative real time PCR.
  2. *bp positions refer to the prototype CAEV-CO molecular clone, GenBank accession number M33677.
Back to article page

Virology Journal

ISSN: 1743-422X