Skip to main content

Table 3 Oligonucleotide sequences of primers utilized to amplify the fragments of CVB3/MKP

From: The whole genome sequence of Coxsackievirus B3 MKP strain leading to myocarditis and its molecular phylogenetic analysis

Primer name Position Nucleotide sequence (5′-3 ′)
C1-S 1-20 TTAAAACAGCCTGTGGGTTG
CI-A 1532-1513 GTAGGTTGATCCATTGGTGG
C2-S 1461-1480 TGGTGTATAATGCAGGCATG
C2-A 2477-2458 CTGTTATCGCGTCTTCCACT
C3-S 2411-2431 TTGAAGGACACTCCTTTCAT
C3-A 3342-3322 CTGTAGTTCCCCACATACGC
C4-S 3103-3122 TGCAAGACATGTCAACGCTG
C4-A 3926-3907 CGTGGTTCCTCACCACAATT
C5-S 3844-3863 GGGTCAAGACTCCATCTTAG
C5-A 4543-4524 GTATCCGTCGAAGTGATCTG
C6-S 4518-4538 CAGACCCAGATCACTTCGAC
C6-A 6351-6321 TTGTCCATACATTCCTTTAA
C7-S 6255-6274 GTGCCGGTTACCCATATGTT
C7-A 7400-7387 AATAATCCGCACCGAATGCG