Skip to main content

Table 3 Primers for specific and long-distance PCR

From: High prevalence and diversity of species D adenoviruses (HAdV-D) in human populations of four Sub-Saharan countries

PCR Gene HAdV species 1st-round primer (5′-3′) 2nd-round primer (5′-3′) 3rd-round primer (5′-3′) Annealing temp. (C°) Fragment size
Sense Anti-sense Sense Anti-sense Sense Anti-sense
Generic PCR Hexon HAdV-D AAGGCCGTCA GTGCGGCTGG ACAACTCGGGCTTCACCGGC GGCTGGTGCA None None 63 322 bp
CCCTGCCCTT TGCACTCTGA CTCTGACCACG
Long distance PCR PVII-Hexon HAdV-D CGCCCAGCAA GTGCGGCTGG GGCAGGACTCGCAGACGAGC GGTGGGCTCA GCGCGGAAAC GGGATGCGCC 60 4.8 kb
    TAACACCGGC TGCACTCTGA   TCCATGGGGT GTGTACTGGGT ACATGACCCT