Skip to main content

Advertisement

Table 3 Predicted promoter sequences of AP5

From: Complete genome sequence of bacteriophage vB_YenP_AP5 which infects Yersinia enterocoliticaof serotype O:3

Name Promoter sequence Number of mismatches Transcription
    Beginning End
ϕGene 0.3 AATTACCCTCACTAAAGGGAAT 4 475 496
ϕGene 1.05 ATTAACCCTCACTAACGGGAGA 1 5970 5991
ϕGene 1.1 GTTAACCCTCACTAACGGGAGA 2 6312 6333
ϕGene 1.3 AATAACCCTAACTAACAGGAGA 4 6823 6844
ϕGene 1.6 ATTAACCCTCACTAACAGGAGA 2 8015 8036
ϕGene 2.5 AATTACCCTCACTAAAGGGAAC 4 9227 9248
ϕGene 4 ATTAACACTCACTAAAGGGATG 3 11000 11021
ϕGene 4.3 ATTAACCCTCACTAACGGGAAC 3 12818 12839
ϕGene 6.5 ATTAACCCTCACTAAAGGGAAG 2 17277 17298
ϕGene 9 AATAACCATCACTAAATGGAGA 3 19816 19837
ϕGene 10A ATTAACCCTCACTAAAGGGAGA 0 20851 20872
ϕGene 13 ATTAACCCTCACTAAAGGGAGA 0 25303 25324
ϕGene 17 ATAAACCCTCACTAAAGGGAGA 0 32975 32996
ϕGene 19.5 ATTAACCCTCACTAAAGGGAGA 0 37842 37863
  Consensus sequence    
AP5 ATTAACCCTCACTAAAGGGAGA    
φYeO3-12 ATTAACCCTCACTAAAGGGAGA    
T3 ATTAACCCTCACTAAAGGGAGA    
T7 TAATACGACTCACTATAGGGAG    
  1. Number of mismatches compared to AP5 consensus sequence.