Skip to main content

Advertisement

Table 1 Primer sequences and annealing temperatures used to sequence the genome of H3N8 EIV

From: An efficient genome sequencing method for equine influenza [H3N8] virus reveals a new polymorphism in the PA-X protein

Primer name Primer sequence (5′-3′) Approximate nucleotide coverage (5′-3′) Annealing temperature used (°C)
PB2/AF GC GTAAAACGACGGCCAGT AGCGAAAGCAGGCAAATATATTCAATATG 1-655 50
PB2/AR GC AACAGCTATGACCATG CTCTTTCTAGCATGTAT
PB2/BF GC GTAAAACGACGGCCAGT CACAACTAACAATAACCAA 569-1335 60
PB2/BR GC AACAGCTATGACCATG CCTCAAGAGTTGATG
PB2/CF GC GTAAAACGACGGCCAGT GCAATAATTGTAGCC 1216-1874 45
PB2/CR GC AACAGCTATGACCATG ATTATTTGAGCAGTATC
PB2/DF GC GTAAAACGACGGCCAGT GAAGCCAATACAGCGGT 1793-2341 50
PB2/DR GC AACAGCTATGACCATG AGTAGAAACAAGG TCGTTTTTAAACAATTC
PB1/AF GC GTAAAACGACGGCCAGT AGCGAAAGCAGG CAAACCATTTGAATGG 1-719 50
PB1/AR GC AACAGCTATGACCATG CAGCGTCCTTGGTCATTG
PB1/BF GC GTAAAACGACGGCCAGT CTTCCAACGAAAGAGAA 577-1301 50
PB1/BR GC AACAGCTATGACCATG GGTTTAATATGGATACACC
PB1/CF GC GTAAAACGACGGCCAGT GCGGCTTCACTGAGTCCTGGC 1222-1863 50
PB1/CR GC AACAGCTATGACCATG CATTTTAAACAAACTTC
PB1/DF GC GTAAAACGACGGCCAGT CAAAGACTGGTCTACTG 1789-2341 50
PB1/DR GC AACAGCTATGACCATG AGTAGAAACAAGG CATTTTTTCATGAAGATC
PA/AF GC GTAAAACGACGGCCAGT AGCAAAAGCAGG TACTGATCCAAAATGG 1-615 50
PA/AR GC AACAGCTATGACCATG GCCTCTCTCGGACTGAC
PA/BF GC GTAAAACGACGGCCAGT GCCAGAATCAAGACCAGG 529-1255 50
PA/BR GC AACAGCTATGACCATG CTCACTTGGAATCCAACTTGC
PA/CF GC GTAAAACGACGGCCAGT GAGAGAAAGTGGATTTTGAGGATTG 1149-1785 50
PA/CR GC AACAGCTATGACCATG CTGAAGGAGGCAGCGCC
PA/DF GC GTAAAACGACGGCCAGT GACCCATGTTTTTGTATG 1700-2233 50
PA/DR GC AACAGCTATGACCATG AGTAGAAACAAGG TACTTTTTTGGACAG
HA/AF GC GTAAAACGACGGCCAGT AGCGAAAGCAGGGGACGATATT 1-515 50
HA/AR GC AACAGCTATGACCATG GATTTGTTAGCCAATTCAG
HA/BF GC GAAAACGACGGCCAGT CAGGTGTCACTCAAAAC G 428-1032 50
HA/BR GC AACAGCTATGACCATG GGATTTGCTTTTCTGGTAC
HA/CF GC GTAAAACGACGGCCAGT GGTTACATATGGAAAATGCC 939-1336 50
HA/CR GC AACAGCTATGACCATG GAGCCACCAGCAATTCT
HA/DF GC GTAAAACGACGGCCAGT GAAGGAAGAATTCAGGA 1251-1733 50
HA/DR GC AACAGCTATGACCATG GAGTAGAAACAAGGGTGTTTTTAAC
NP/AF GC GTAAAACGACGGCCAGT AGCGAAAGCAGGGTAGATAATC 1-570 50
NP/AR GC AACAGCTATGACCATG CCGTGGGAGGGTTGAGCC
NP/BF GC GTAAAACGACGGCCAGT GACACCACATACCAAAC 480-1075 45
NP/BR GC AACAGCTATGACCATG CTCTCAGGTCCTCAAAT
NP/CF GC GTAAAACGACGGCCAGT CCAGCACACAAGAGCCAG 1012-1569 55
NP/CR GC AACAGCTATGACCATG AGTAGAAACAAGGGTATTTTTC
NA/AF GC GTAAAACGACGGCCAGT AGCAAAAGCAGGAGTTT 1-508 45
NA/AR GC AACAGCTATGACCATG GCCCTATTTTGACACTC
NA/BF GC GTAAAACGACGGCCAGT CACACAGGGCTCATTAC 417-1049 45
NA/BR GC AACAGCTATGACCATG CCGAAACCTTTTACACCG
NA/CF GC GTAAAACGACGGCCAGT CACAGTTGGATATTTGTG 951-1461 50
NA/CR GC AACAGCTATGACCATG AGTAGAAACAAGGAGTT
M/AF GC GTAAAACGACGGCCAGT AGCGAAAGCAGGTAGATATTTAAAG 1-654 50
M/AR GC AACAGCTATGACCATG CTAGCCTTACTAGCAAC
M/BF GC GTAAAACGACGGCCAGT CAGTACCACGGCTAAAG 571-1027 50
M/BR GC AACAGCTATGACCATG AGTAGAAACAAGGTAGTTTTTTAC
NS/AF GC GTAAAACGACGGCCAGT AGCGAAAGCAGGGTGACAAAAAC 1-492 50
NS/AR GC AACAGCTATGACCATG CTGCTCCTTCTTCGGTG
NS/BF GC GTAAAACGACGGCCAGT CATCATACTTAAAGCAAAC 407-890 50
NS/BR GC AACAGCTATGACCATG AGTAGAAACAAGGTAGTGTTTTTTAT