Skip to main content

Table 2 Primers used during the construction of full-length flavivirus chimeric DNAs

From: Substitution of the premembrane and envelope protein genes of Modoc virus with the homologous sequences of West Nile virus generates a chimeric virus that replicates in vertebrate but not mosquito cells

Primer Polarity Sequencea Target
M-F1 Sense 5’ACATTTCCCCGAAAAGTGCCACCTGACGTCTCGAC3’ Cloning vector
MW-R1 Antisense 5’CCTCCTGGTTTCTTAGACAT TCCCGCCACAAAAAGTGG3’ WNV/MODV
MWi-R1 Antisense 5’TAACTGCTCCTACGCTGGCGAT TGACAATATGGTTCCCATCATCC3’ WNV/MODV
MC-R1 Antisense 5’CTTACCGTCGTCCTTTCCCAT TCCCGCCACAAAAAGTGG3’ CxFV/MODV
MCi-R1 Antisense 5’ACGGCGCCCAGCACCATCAT TGACAATATGGTTCCCATCATC3’ CxFV/MODV
MW-F2 Sense 5’CCACTTTTTGTGGCGGGAATGTCTAAGAAACCAGGAGG 3’ MODV/WNV
MWi-F2 Sense 5’ATGGATGATGGGAACCATATTGTCAATCGCCAGCGTAGGAGCAG 3’ MODV/WNV
MC-F2 Sense 5’CCACTTTTTGTGGCGGGAATGGGAAAGGACGACGGTAAG 3’ MODV/CxFV
MCi-F2 Sense 5’ATATGGATGATGGGAACCATATTGTCAATGATGGTGCTGGGCGCCGTC 3’ MODV/CxFV
MW-R2 Antisense 5’CAAGGACACAGCCATGATCAGCGTGCACGTTCACGGAG 3’ MODV/WNV
MC-R2 Antisense 5’CATCAAGGACACAGCCATGATCTGCCTTGGTGTAGATAAAGTATCC 3’ MODV/CxFV
MW-F3 Sense 5’CTCCGTGAACGTGCACGCT GATCATGGCTGTGTCCTTG3’ WNV/MODV
MC-F3 Sense 5’GGATACTTTATCTACACCAAGGCA GATCATGGCTGTGTCCTTGATG3’ CxFV/MODV
M-R3 Antisense 5’TCCATTTGCATTGATGACTGGAGAACCAGATGAACCAGGAGG3’ MODV
M-F4 Sense 5’AGACTCTTATTCTTGGGGTGGG3’ MODV
T7MOD-F Sense 5’TAATACGACTCACTATAGG AGTTGATCCTGCCAGCGGTG3’ T7/MODV
M-R10600 Antisense 5’AGCGGAGGTCATATTCATGACCACACAGATTACATG3’ MODV
  1. aHeterologous virus sequences are italicized in chimeric primers, T7 promoter sequence is bolded.