Skip to main content

Advertisement

Table 9 Primers used in the study

From: Phylogenetic relationships and pathogenicity variation of two Newcastle disease viruses isolated from domestic ducks in Southern China

Primers Sequences (5′-3′) Position Expected extent (bp) Expected size (bp)
1Fa ACCAAACAGAGAATCCGTGAG 1-21 1-1 270 1 270
1Rb CTTTAGCTCGGCAGCCATATCCTC 1258-1270
2F TGAGCACATCATTCTGGAGACTTG 1185-1207 1 185–2 280 1 096
2R TGGACGATTTATTGCTAAGCTTG 2259-2280
3F CTAAGCACAGCATGGGAGAAG 2025-2046 2 025–3 432 1 408
3R AAGTCAAGACGCTGGATCCT 3413-3432
4F CACAGGAGATGGGAAGAAGC 3376-3395 3 376–5 330 1 955
4R ATGAGCTGAGTTGATTGTTCC 5310-5330
5F CAGTTGGGAAGATGCAGCAG 5076-5095 5 076–6 873 1 798
5R AGAGGGATAGAATGATGTGAC 6853-6873
6F CCTGTTCATGACCCAGACTAC 6787-6807 6 787–8 520 1 734
6R TCGAAGTCACATTCATCAGG 8501-8520
7F GATCAGATGAGAGCCACTACAA 6471-6492 6 471–8 448 1 978
7R GATAGATGTGACTCTGGTAGGAT 8426-8448
8F AGAGGGAACACGGGTAGGA 8376-8394 8 367–10 054 1 688
8R CTTAGCAAAAATCCGCCCA 10036-10054
9F ATCGTACTCACTCAAAGAGA 10000-10019 10 000–11 747 1 748
9R GGGCATAATCTGCTAGCGTC 11728-11747
10F TGACGCTAGCAGATTATG 11727-11744 11 727–13 422 1 696
10R TCCTGAGGGAACAACAAT 13405-13422
11F TCTTTCCAATGACAACAACC 12604-12623 12 604–14 589 1 986
11R GACCGGATAACTGTGTCAAT 14570-14589
12F AAGATTCGTCCAGGGTCC 14033-14050 14 033–15 192 1 160
12R ACCAAACAGAGATTTGGTGAA 15172-15192
  1. aF stands for forward primer.
  2. bR stands for reverse primer.