Skip to main content

Table 2 Sequences of primers used to amplify the 3,408 fragment of ball python Nidovirus

From: Identification of a novel nidovirus in an outbreak of fatal respiratory disease in ball pythons (Python regius)

Primer name* Sequence 5′ – 3′ Nucleotide position
BPNV 1Fwd BPNV 1Rev ACCTGCTACCGATGTCCAAG GTCGTTGTTGGCTGAGTGTG 1-963
BPNV 2Fwd BPNV 2Rev TTCAAGCGAACCAAGTTCATCC TCTTGGACATCGGTAGCAGG 718-1485
BPNV 3Fwd BPNV 3Rev AACATCCTCGACAACGCAGG ACGTAGTCTTGCCAGTTCCC 1446-1647
BPNV 4Fwd BPNV 4Rev CCACAACCCGACAGTCAGTA GTACGTAGTCTTGCCAGTTCC 1456-2154
BPNV 5Fwd BPNV 5Rev GGCACAGTAACAGCACAACG GTACTGCAAGATGCCGTTGC 2152-3030
BPNV 6Fwd BPNV 6Rev GTGACTACACGAAATGCGACC GTCAAACATGAAAGCGTGCG 2995-3131
BPNV 7Fwd BPNV 7Rev GTCGTCAACTTGTCCCACCA CTGCCATGCTACGGAAGACT 3088-3408
  1. *PCR cycling conditions: 95°C for 10 minutes followed by 35 cycles of 95° C for 30 seconds, 55°C for 30 seconds, 72°C for 1 minute, except primer pair BPNV 1 and BPNV 6 where annealing temperature was 53°C.