Skip to main content

Table 3 Primers for amplification of RSV gene fragment

From: Development of a reverse genetics system for respiratory syncytial virus long strain and an immunogenicity study of the recombinant virus

Primer name Primer sequence (5’-3’) Gene products (bp)
pF RSV-A ACGCGTCGAC ACGCGAAAAAATGCGTACAACAAAC 2130 bp
pR RSV-A AGCCCTAGG CCAGCAGCATTGCCTAATACTAC  
pF RSV-B AGCCCTAGG CATAATGGGAGAGTACAGAGG 2323 bp
pR RSV-B CCGCTCGAG CTCTTGGTAACTCAAAGGTTTTG  
pF RSV-C CCGCTCGAG TCAACACATAGCATTCATCAATC 1200 bp
pR RSV-C GCGGCCGC TTGTGATAATATGTTTTTTAATAAC  
pF RSV-D GCGGCCGC GACCAACTCAAACAGAATCAAAAT 2800 bp
pR RSV-D CGCGGATCC ATTTTGTCCCACAGCTTGAATTAT  
pF RSV-E CGCGGATCC CATTATTAATGGAAATTCTGCTAA 2502 bp
pR RSV-E CTAGCTAGC AAATAATCTGCTTGAGCATGAGT  
pF RSV-F CTAGCTAGC ATTAAATAGCCTTAAATTACTGTA 4218 bp
pR RSV-F CGGGGTACC ACGAGAAAAAAAGTGTCAAAAACT  
  1. All the primers were designed based on the whole sequence of long strain of Respiratory syncytial virus (GenBank Accession: AY911262.1). The restriction enzyme sites within the primers are italic. “F” stands for forward and “R” stands for reverse to represent the direction of primer extension.