Detection of Middle East respiratory syndrome coronavirus using reverse transcription loop-mediated isothermal amplification (RT-LAMP)

Table 1 The primer set for MERS-CoV RT-LAMP assay

Primers	Position (EMC, JX869059.2)	Sequence (5′ – 3′)	Number of matched MERS sequences*
F3	28848–28866	GCTCCCAGGTGGTACTTCT	86/88
B3	29061–29042	cagtcccctcaatgtggaag	88/88
FIP (F1c + F2)	28939–28918	tcatggacccaaacgatgccatACTGGAACTGGACCCGAAG	77/88
FIP (F1c + F2)	+ 28872–28890	tcatggacccaaacgatgccatACTGGAACTGGACCCGAAG	88/88
BIP (B1c + B2)	28956–28977	GCTCCTTCAACTTTTGGGACGCtagtaccgggcgcgaatt	87/88
BIP (B1c + B2)	+ 29028–29011	GCTCCTTCAACTTTTGGGACGCtagtaccgggcgcgaatt	83-88
LF	28906–28891	cggaatgggagtgctg	88/88
LB	28978–29000	GGAACCCTAACAATGATTCAGCT	85/88

Capital letters indicate the sense strand; lowercase letters indicate the antisense strand.
*Eighty-one sequences were obtained from GenBank (JX869059, KJ829365, KJ813439, KJ713299, KJ713298, KJ713297, KJ713296, KJ713295, KJ650297, KJ650296, KJ650295, KJ650098, KJ556336, KJ477102, KJ156953, KJ156952, KJ156949, KJ156944, KJ156942, KJ156939, KJ156934, KJ156932, KJ156927, KJ156917, KJ156916, KJ156913, KJ156911, KJ156910, KJ156909, KJ156907, KJ156906, KJ156905, KJ156902, KJ156901, KJ156883, KJ156881, KJ156876, KJ156874, KJ156873, KJ156872, KJ156871, KJ156869, KJ156866, KJ156865, KJ156862, KJ156861, KF961222, KF961221, KF958702, KF917527, KF811035, KF745068, KF600652, KF600651, KF600647, KF600645, KF600644, KF600643, KF600639, KF600636, KF600635, KF600634, KF600632, KF600630, KF600628, KF600627, KF600623, KF600621, KF600620, KF600613, KF600612, KF192507, KF186567, KF186566, KF186565, KF186564, KC875821, KC776174, KC667074, KC164505, and KJ782550) and seven sequences were obtained online (England2-HPA, http://www.hpa.org.uk/webc/HPAwebFile/HPAweb_C/1317138176202: Jeddah_2014_C7149, C7569, C7770, C8826, C9055, and C9355, http://www.virology-bonn.de/index.php?id=46).

ISSN: 1743-422X