Skip to main content

Advertisement

Table 1 Primer and probe sequences used in the respiratory virus multiplex assays

From: Pandemic clinical case definitions are non-specific: multiple respiratory viruses circulating in the early phases of the 2009 influenza pandemic in New South Wales, Australia

Virus (target gene) Name Sequence (5′ to 3′ end) Reference
RSV (nucleoprotein) RSVF For: tagtgtrcargcagaaatgg in-house
  RSVAR Rev: agtgrggaaattgagtcaaagat in-house
  RSVBR Rev: rggraattgagttaatgacagc in-house
  RSVP Probe: FAM tgatgcttttggrttrttcaatatatgg BHQ1 in-house
Influenza A (matrix) AMF2 For: atggaatggctaaagacaagac [9]
  AMR2 Rev: cattkagggcattytggac in-house
  AMP Probe: Cal fluo Red610 acgctgcagtcctcgctcact BHQ2 in-house
Influenza B (nucleoprotein) BNF For: yaacgatgacatggagagaaac in-house
  BNR Rev: gcctcctgttttgttgtgatc in-house
  BNP Probe: Quasor670 ccttctttsacatctctggcattctt BHQ2 in-house
Parainfluenza 1 (matrix) PI1F For: yggaacatcactaggtacaatyac in-house
  PI1R Rev: gagcttcttttctccatcatc in-house
  Para1P Probe: aactcttgcagatcttgcattaccg in-house
Parainfluenza 2 (matrix) PI2F For: tcactgtggtcagttggatgt in-house
  PI2R Rev: ctcaaatgtccgttgacctg in-house
  Para2P Quasor670 aagaatctgatcttaatgagctaatgggc BHQ2 in-house
Parainfluenza 3 (matrix) PI3F For: Cal fluo Red610 gaagtgagaagaacagtyaaagc BHQ2 in-house
  PI3R Rev: cattgaggagcaagagcaac in-house
  Para3P Probe FAM ttggcatcgaacarcattcc BHQ1 in-house
Rhino & Entero (5′UTR) Rhi3A For: gcccctgaatgyggctaa [10]
  Rhi4B Rev: gaaacacggacacccaaagta [10]
  Rhi1P Probe: FAM tggtcccrtcccgcamttgc BHQ1 in-house
  Rhi2P Probe: FAM ccrtcccrsaattgctcrttacgac BHQ1 in-house
  Ent1P Probe: Cal fluo Red610 cggttccgctgcrgagttrccc BHQ2 in-house
  Ent2P Probe: Cal fluo Red610 cggttccgccacrgacttrcgc BHQ2 in-house
hMPV (nucleoprotein) Meta NLNF For: catayaarcatgctatattaaaagagtctc [11]
  Meta NLNR Rev: cctatytctgcagcatatttgtaatcag [11]
  MetaP Probe:Quasor670 tcttgytgcaatgatgarggtgtyactgc BHQ2 [11]
Adeno (hexon) AdeF For: caaggaygtmaacatgatcctgcag in-house
  AdeF For: raaggatgtdaacatgrtbctdcag in-house
  AdeR Rev: cgttggtrtcgttrcgcagcat in-house
  AdeR Rev: crttggtrtcrttycknarcat in-house
  Ade1P Probe: FAM trgaagckgtgttrtgwgccatggg BHQ1 in-house
  Ade2P Probe: FAM tggaggcsgtgttgtgsgccatggg BHQ1 in-house
Human Beta-globin PCO3 For: acacaactgtgttcactagc [8]
  PCO4 Rev: caacttcatccacgttcacc [8]
  BGLP Probe: Quasor670 tcaaacagacaccatggtgcacctga BHQ2 in-house