Skip to main content

Advertisement

Table 1 Oligonucleotides of vector-delivered pre-miRNAs

From: Multiple microRNAs targeted to internal ribosome entry site against foot-and-mouth disease virus infection in vitro and in vivo

Name Single stranded DNA sequences (5′ → 3′) Position
pmiR153 Top strand TGCTGCTCCTTGGTAACAAGGACCCAGTTTTGGCCACTGACTGACTGGGTCCTTTACCAAGGAG 151–171
Bottom strand CCTGCTCCTTGGTAAAGGACCCAGTCAGTCAGTGGCCAAAACTGGGTCCTTGTTACCAAGGAG C
pmiR220 Top strand TGCTGGCACGGCAACTTTACTGTGAAGTTTTGGCCACTGACTGACTTCACAGTAGTTGCCGTGC 220–240
Bottom strand CCTGGCACGGCAACTACTGTGAAGTCAGTCAGTGGCCAAAACTTCACAGTAAAGTTGCCGTGC C
pmiR242 Top strand TGCTGCCACCTTAAGGTGACACTGATGTTTTGGCCACTGACTGACATCAGTGTCCTTAAGGTGG 243–263
Bottom strand CCTGCCACCTTAAGGACACTGATGTCAGTCAGTGGCCAAAACATCAGTGTCACCTTAAGGTGG C
pmiR276 Top strand TGCTGCACTGGTGACAGGCTAAGGATGTTTTGGCCACTGACTGACATCCTTAGTGTCACCAGTG 277–297
Bottom strand CCTGCACTGGTGACACTAAGGATGTCAGTCAGTGGCCAAAACATCCTTAGCCTGTCACCAGTG C
pmiR-NC Top strand TGCTGAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Heterologous
Bottom strand CCTGAAATGTACTGCGTGGAGACGTCAGTCAGTGGCCAAAACGTCTCCACGCGCAGTACATTT C
  1. The sense sequences of predicted miRNAs targeting the FMDV IRES are shown in bold and italic.