Skip to main content

Table 4 Real-time quantitative RT-PCR primers

From: Transcriptional analysis of the innate immune response of ducks to different species-of-origin low pathogenic H7 avian influenza viruses

RNA target Forward primer (5’ – 3’) Reverse primer (5’ – 3’) Genbank accession # Ref.
IFNA GACAGCCAACGCCAAAGC AATGCTTGAGCAGCAGCGAC EF053034 (5)
IFNB CCTCAACCAGATCCAGCATT GGATGAGGCTGTGAGAGGAG AY831397 (5)
IFNG CAACGCTCAACTACTCTC TGTGGTTAATCTGTCCTTAG AJ012254 DK
IL1B TCGACATCAACCAGAAGTGC GAGCTTGTAGCCCTTGATGC DQ393268 (5)
IL2 GCCAAGAGCTGACCAACTTC ATCGCCCACACTAAGAGCAT AF294323 (5)
IL6 TTCGACGAGGAGAAATGCTT CCTTATCGTCGTTGCCAGAT AB191038 (5)
MHCI GAAGGAAGAGACTTCATTGCCTTGG CTCTCCTCTCCAGTACGTCCTTCC AB115246 (5)
MHCII CCACCTTTACCAGCTTCGAG CCGTTCTTCATCCAGGTGAT AY905539 (5)
TLR7 CCTTTCCCAGAGAGCATTCA TCAAGAAATATCAAGATAATCACATCA AY940195 (5)
GAPDH ATGTTCGTGATGGGTGTGAA CTGTCTTCGTGTGTGGCTGT AY436595 (5)