Skip to main content

Table 1 Primers and probes for detecting of matix, H5 and H7 genes of avian influenza viruses

From: Application of real-time reverse transcription polymerase chain reaction to the detection the matrix, H5 and H7 genes of avian influenza viruses in field samples from South Korea

Gene Primer or probe Sequence Product size (bp) Reference
Matrix M-Kr forward AAGACCAATCCTGTCACCTCTGA 104 [21]
M-Kr reverse CAAAGCGTCTACGCTGCAGTCC [21]
M-Kr probe FAM-TTTGTNTTYACGCTCACCGTGCC-TAMRA modified [21]
H5 H5-Kr forward TGACTACCCGCAGTATTCAG 145 [20]
H5-Kr reverse AGACCAGCTAYCATGATTGC modified [20]
H5-Kr probe FAM-TCAACAGTGGCRAGTTCCYTAGCA-TAMRA modified [20]
H7 H7-Kr forward ATAGCRGGTTTYATTGAAAA 134 newly designed
H7-Kr reverse CCTGTTATTTGATCAATTGC newly designed
H7-Kr probe FAM-TGGGAAGGTCTVRTTGAYGG-TAMRA newly designed