Skip to main content

Table 1 Primer sets designed for RT-LAMP assay detection of TBEV in this study

From: Development of simple and rapid assay to detect viral RNA of tick-borne encephalitis virus by reverse transcription-loop-mediated isothermal amplification

Primer Sequence Genome position* Length (bp)
TBEV-F3 ACCATAAATGCCGACTGTGA 3319–3338 20
TBEV-B3 TGCCACCACCATTGAGC 3500–3516 17
TBEV-FIP CGGCAGCACCACTCTGGAATTCGGGGGCTTCTGTGAGGA 3345–3361 39
3385–3404
TBEV-BIP TGCACACTACCTCCAGTGACGTGAATTCATGAACAGGACGTATTTCC 3409–3430 47
3462–3480
TBEV-LF ACCTTGCCACTCTCTGTGG 3365–3383 19
TBEV-LB ACGGGGACAGACTGTTGGTATGC 3436–3485 23
FE-F3 TTGACCTTGCTCAGACTGTC 1547–1566 20
FE-B3 CGTCCATTTTCACAGCGTGT 1713–1732 20
FE-FIP TGAACCAGTCCCGGTGGACCTTGGAGCTTGACAAGACCTC 1569–1589 40
1615–1633
FE-BIP GCCCTGCCGTGGAAACATGAGGAGCTCCAAACTCAACCA 1642–1663 39
1694–1710
FE-LF CAGGCCGTCGGTAGGTGTTC 1591–1610 20
FE-LB GGGAGCACAAAACTGGAACA 1662–1681 20
Sib-F3 CCACTCTGGCTGAAGAACAT 1211–1230 20
Sib-B3 ATTGGCGGCAACGTAGTC 1417–1434 18
Sib-FIP GCCCTTTCCAAACAGTCCGCAAGCACGGTGTGCAAGAGAG 1240–1255 40
1285–1305
Sib-BIP TGAGGCAAAGAAGAAGGCCACTCGTGTGTGGCTCAACCTTA 1335–1356 41
1395–1413
Sib-LF CCCAGCCTCGATCACTCTGGT 1256–1276 21
Sib-LB GGACATGTGTATGACGCCAACAAG 1357–1380 24
EU-F3 CGCAAAACTGGAATAACGCA 1667–1686 20
EU-B3 CCACTTCGCAGGTCACATG 1831–1849 19
EU-FIP ACTCCAGTCTGGTCTCCGAGGACTGGTTGAATTTGGGGCTC 1691–1711 41
1741–1760
EU-BIP GTTACTGAAGGCTCTCGCTGGGGCCACTCTTCAGGTGGTACT 1761–1783 42
1811–1829
EU-LF ACACGTCCATCTTGACAGCGT 1715–1735 21
EU-LB GTTCCTGTGGCACACATTGA 1783–1802 20
  1. *genome position is based on the sequence of Neudoerf strain (accession no. TEU27495).