Skip to main content

Table 1 The primers used in the present study

From: Analysis and mapping of a 3 coterminal transcription unit derived from human cytomegalovirus open reading frames UL30–UL32

Experiments Primer names Primer sites (5-3) Primer sequences (5-3)
cDNA library screening P1-F 37664-37645 ACAGCGAGCAGCAGGAGTT
  P1-R 37365-37384 AGAGCCCGTCGTGATAGTCC
  P2-F 38763-38744 ACCGCCTGCGACTGCCGCAT
  P2-R 38564-38583 TACAACAACACGCAGGGCTG
Northern blotting a and RT-PCR P0-F 37250-37231 TAGTCTCGTTTTTTATTAAA
  P0-R 37011-37030 CAGTCCGCGACGATCCACAG
  P1-Fb 37664-37645 ACAGCGAGCAGCAGGAGTT
  P1-Rb 37365-37384 AGAGCCCGTCGTGATAGTCC
  P2-Fb 38763-38744 ACCGCCTGCGACTGCCGCAT
  P2-Rb 38564-38583 TACAACAACACGCAGGGCTG
  P3-F 40306-40288 CGTCGGTGTTCCTTCCTT
  P3-R 39997-40014 CATGCCCGTCGTGCTCTT
  P4-F 42945-42926 GTCAACTTTCTGCGCCATCT
  P4-R 42498-42516 GCTGCACCTCCGTATCCTT
  P3-1-F 40673-40654 AGAAACCGGTGCTGGGCAAG
  P3-1-R 40430-40447 ACGGACGCCGAGGCTGAC
  P3-2-F 41023-41005 TCCCTTCAGGATGCCTACG
  P3-2-R 40784-40801 TCGGACGACGGTGTTGTG
  P3-3-F 41361-41344 GATCCGCGTTTCACCGAC
  P3-3-R 41115-41132 CCCAGGGCGAGTTACCGT
3 RACE GSP-3’out primer 37713- 37694 CATGTAGCCGACTTGGAGGA
  P1-F 37664-37645 ACAGCGAGCAGCAGGAGTT
  P2-R 38564 -38583 TACAACAACACGCAGGGCTG
  UL31-3’-in 39310-39327 CCGCAACCCGTCACTCTT
5 RACE GSP-5’out primer 37342- 37359 AAAGGCACGCTGTTGACG
  P1-R 37365-37384 AGAGCCCGTCGTGATAGTCC
  GSP-5’-2 37801-37820 CGGGAAGAGGTTCTTCTCCC
  GSP-5’-3 38349-38367 ACGTGGTGACCTCGTGGAT
  GSP-5’-4 38743-38762 CATGCGGCAGTCGCAGGCGG
  GSP-5’-5 42522-42539 GCACAAAGGCGATGGGTT
  GSP-5’-6 42803-42823 CGGTAGTATCCCAACCAAAGC
  1. a. The additional oligonucleotide of 5-AATACGACTCACTATAGG-3 was added to the 5 ends of the reverse primers for the templates of all the Northern blotting probes and acted as the promoter of T7 RNA polymeras.
  2. b. These primers were for the template of the complementary probes of probe-1 and anti-probe-1, as well as probe-2 and anti-probe-2, which were switched as the forward and reverse primers.