Skip to main content

Table 2 Primers used in this study

From: Characterization of an envelope gene VP19 from Singapore grouper iridovirus

Primer name Primer sequence (5′-3′)
pET-VP19t-F CGGAATTCATGGCATCGTCCACTATAC
pET-VP19t-R GCCAAGCTTAATACTTTGAAAAATCGC
EGFP-VP19-F CGCAAGCTTCGATGGCATCGTCCACTATAC
EGFP-VP19-R AGTGGATCCCCCAAAAGAGCCCTTCATT
VP19-F TCCAAGGGAGAAACTGTAAG
VP19-R GGGGTAAGCGTGAAGACT
MCP-F GCACGCTTCTCTCACCTTCA
MCP-R AACGGCAACGGGAGCACTA
Actin-F TACGAGCTGCCTGACGGACA
Actin-R GGCTGTGATCTCCTTCTGCA