Skip to main content

Table 1 Primer sequences used in PCR assays

From: One case of swine hepatitis E virus and porcine reproductive and respiratory syndrome virus Co-infection in weaned pigs

Primer Sequence 5′-3′ Reference
PRRSV ORF7 gene   
PRRSV-F CCAAATAACAACGGCAAGCA  
PRRSV-R ATGCTGAGGGTGATGCTGTGA
HEV ORF2 gene   
HEV- externer primer AATTATGCYCAGTAYCGRGTTG [8]
HEV- externer primer CCCTTRTCYTGCTGMGCATTCTC
HEV- interner primer GTWATGCTYTGCATWCATGGCT
HEV- interner primer AGCCGACGAAATCAATTCTGTC
CSFV E2 gene   
E2- externer primer GCATCAACCAYKGCATTCC [11]
E2- externer primer GTCTGTGTGGGTRATTAAGTTCCCTA
E2- interner primer CTRGTRACTGGGGCACAAGG
E2- interner primer ACCAGCRGCGAGTTGYTCTG
PCV2 ORF2 gene   
PCV2.S4 CACGGATATTGTAGTCCTGGT [12]
PCV2.A4 CCGCACCTTCGGATATACTGTC