Skip to main content

Table 2 Primers for cloning CMV-launched pKUN--NS1

From: Non-structural protein-1 is required for West Nile virus replication complex formation and viral RNA synthesis

Primer Sequence (5′ – 3′) ( MluI)
NS1-Mlu1-A-forward GCTGATACTGGATGTACGCGTGATATAAGTCGGCAAG
NS1-Mlu1-A-reverse CTTGCCGACTTATATCACGCGTACATCCAGTATCAGC
NS1-Mlu1-B-forward CATCGTGGACCTGCCACGCGTACCACTACAGAGAG
NS1-Mlu1-B-reverse CTCTCTGTAGTGGTACGCGTGGCAGGTCCACGATG