Skip to main content

Table 1 Primers for cloning NS1 from different flaviviruses

From: Non-structural protein-1 is required for West Nile virus replication complex formation and viral RNA synthesis

Primers Sequence (5′-3′)
WNV NS1 forward GTGGATGGGCGGCCGCACCATGGATAGGTCCATAGCTCTCACGTTT
WNV NS1 reverse CATTGACTGCGGCCGCTAAGCATTCACTTGTGACTGCAC
DENV NS1 forward GCGGCCGCACCATGGTCTCACTGTCTGTGACACTAG
DENV NS1 reverse TCAAGCTGTGACCAAGGAGTTGAC
YFV NS1 forward GCGGCCGCACCATGGACATGACAATGTCCATGAGCA
YFV NS1 reverse TCAAGCTGTAACCCAGGAGCGCACCAG
JEV NS1 forward GCGGCCGCACCATGGACCGATCAATTGCTTTGGCC
JEV NS1 reverse TCAAGCATGAACCTGTGATCTGACG
SLEV NS1 forward GCGGCCGCACCATGGACAGGAGCATCTCGCTGACTC
SLEV NS1 reverse TCAAGCTGTCACGCGAGATTTCACAAG